go back to Knowledge and to PCR

PLAN
many laboratory now use real time RT-PCR !

1. definition
2. is it useful
3. where is the RNA.
4. DNA pol, RT-DNA pol and primers primers.
5. RT-PCR requires pure RNA.
6. detect splice variants.

.........................................

7. RT, which primer? specific or poly T
8. from RT to PCR.
9. test your knowledge

by answering questions
by being able to explain RT PCR in materials and methods
by discussing RT PCR data from scientific papers.

1. definition.

RT PCR stands for reverse transcription and polymerase chain reaction. It is the PCR amplification of a reverse transcription product.

RT PCR amplifies very small amounts of any kinds of RNA (mRNA, rRNA, tRNA etc.).

It requires:
..an RT DNA pol (retroviral origin),
..a thermoresistant DNA pol 1(Bacteria or Archea),
..a sense ant antisense primers,
..a buffer,
..the 4 dNTPS.

return to top

2. is it useful

1. Could it be used for the detection of cells migrating in blood, by tracking RNA molecules specific to the kind of cell under investigation:
............prostate cells.
............breast cells.
............thyroid cells

2. detection and quantification of gene transcripts in cell lysate.

 

return to top

3. DNA, RNA and primers.

In eukarya most of the RNA is translocated from the nucleus to the cytoplasm.

Let's imagine a 2 exon eukaryotic gene in an eukaryotic cell nucleus.
This gene is transcribed into an immature RNA.

Post-transcriptional processing take place in the nucleus producing a mature RNA that is translocated from the nucleus to the cytoplasm through nuclear pores.

An RNA molecule has the same base sequence than the sense (+) DNA strand of its coding gene, except for
............T's, which are replaced by U's,
............ribose replaces deoxyribose
............the presence introns, which are frequently spliced out (remember that there are splice variants).

The picture makes it clear that the RNA is complementary to the antisense (-) DNA strand.

Archae, Bacteria and mitochondria don't have any nucleus. Transciption and translation take place in the same compartment.

A primer recognizes both the DNA or its transcript RNA and bind to them.

 

return to top

4. DNA pol, RT-DNA pol and primers

primers for DNA are small synthetic sequences computed from sense (+) and antisense (-) strands. They are complementary to sequences on the opposite strand.

an antisense primer (as) from an exon is complementary to the RNA transcribed from this exon.

 

DNA pol I extends the 3' end of primers annealed to DNA single strand templates, using dNTPs.

RT DNA pol, or RT pol extends the 3' end of antisens primers annealed to a RNA or DNA template, using dNTPs.

return to top

5. RT-PCR requires pure RNA.

primers anneal both to a RNA sequence and the DNA sequence that codes for it. So If Some DNA contaminates your RNA preparation, get rid of it.
centrifugation and phenol-chloroform RNA purification methods are both know to bring about DNA contamination. There are nice commercial kits.

These kits including a DNAse cleaning step.

You can also choose primers located in different exons. The product amplified from the DNA will be longer that the one produced from the RNA. They can the be seen as two differents bands on pherograms.

You can also compute the extension time to avoid long DNA extensions.

return to top

...........................

6. detect splice variants.

If you suspect a splice variant and know the unspliced intron, chose a primer in each of the exons surrounding this intron. So RT PCR will get two populations of sequences: large ones (unspliced) and small one (spliced). This is a case where you must be sure that your RNA is not contaminated by genomic DNA.

return to top

7. RT, which primers?

primer specific to the gene

pipet an aliquot of total RNA in a microcentrifuge tube
add an "as" primer, the 4 dNTPs, the right buffer, RT DNA pol, and incubate at 45°C for 45 minutes.

RT DNA pol extends the "as" primer synthesizing the ss (single strand) cDNA strand of a hybrid c DNA-RNA duplex.

 

aspecific poly T primer

the primer is a 18 nt poly T. The product of the reaction is a family of ss cDNA s, poly T cDNAs. poly T can only bu used with polA mRNA, not with histone mRNA or ordinary RNA

 

return to top

8. from RT to PCR.

with "s" and "as" primers

 

add the "s" and evetually the "as" primers and a thermostable DNA pol 1.
warm (95°C) to separate the DNA strands
cool down to a temperature allowing only perfect primers to anneal
let them anneal
bring the mixture to the optimal temperature for thermostable DNA pol activity.

You will get two populations of DNA molecules long ones and short ones.
Length of the short ones will be that of the sequence between the 5' ends of the two primers.
The number of the long ones will grow arithmetically, and the number of the short ones will grow geometrically as in regular PCR.

 

return to top

9. test.

1. what's the meaning of transcription, translocation, translation, and expression?
2. cite three postranscriptional modifications. Where do they take place?
3. what does the word structural gene mean ?
4. are in vivo primers RNA or DNA sequences?
5. what's a dNTP? a ddNTP?
6. give an example of cis-splicing and of trans-splicing.

 

7. why should you avoid using DNA contaminated RNA for RT PCR?
8. why is RT PCR thought to be useful in the diagnosis of some cancers? What's real time RT-PCR ?
9. for a given couple of primers, do all RT PCR products have the same length? why?
10. Describe thyroperoxidase RT PCR material and methods as you would do it if you have to publish it.

return to top

 

A. Reverse Transcription-PCR (RT-PCR).

Isolation of poly(A) RNA was performed by using the MicroFastTrack 2.0 kit (Invitrogen) according to the manufacturer's instructions. Poly(A) RNA (500 ng) or total RNA (5 µg) was denatured for 2 min at 70°C in the presence of 50 pmol of oligo(dT) primer (Invitrogen). Single-stranded cDNAs were prepared in a 10-µl reaction mixture containing 250 µM dNTPs, 2 mM DTT, 8 units of RNasin (Roche Molecular Biochemicals, Indianapolis, IN), and 50 units of Superscript II RT (Life Technologies, Rockville, MD) and incubated for 90 min at 42°C. The samples were then diluted with 75 µl of 10 mM Tris·HCl, pH 7.5, and incubated at 72°C for 10 min. cDNA (3 µl) was used for PCR that contained 250 µM dNTPs, 25 pmol of each respective primer, and 1 unit of AmpliTaq DNA polymerase (Roche Molecular Biochemicals) and amplified for 35 cycles. Similar PCR conditions were used on the human breast RAPID-SCAN gene expression panel (OriGene Technologies, Rockville, MD). Primers TCRJ1.2R, TCR5.1, and TCR3.1 were used to detect the TARP transcript, whereas primers B-Actin Forward and B-Actin Reversewere used to detect the actin transcript.

TARP: a nuclear protein expressed in prostate and breast cancer cells derived from an alternate reading frame of the T cell receptor gamma chain locus
Wolfgang CD, Essand M, Vincent JJ, Lee B, Pastan IProc. Natl. Acad. Sci. USA, Vol. 97, Issue 17, 9437-9442, August 15, 2000

return to top

B. Quantitative Reverse Transcriptase (RT)-PCR.

The quantitative RT-PCR for growth hormone (GH), proopiomelanocortin (POMC), and thyroid-stimulating hormone (TSH) genes was performed. Total RNA with DNase I treatment was used to synthesize first-stand cDNA with RT (GIBCO/BRL) and oligo(dT) 15 Primer (Promega). The products of the RT reactions was used to seed real-time PCR by using an ABI Prism 7700 Sequence Detector by comparing with glyceraldehyde -3-phosphate dehydrogenase (internal control) and individual standard curve with three time repeats. Probes were labeled with quencher and fluorescent dye 6-FAM by 5' and 3' ends, respectively.

Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning. R.-M. Hu et al.
Proc. Natl. Acad. Sci. USA, Vol. 97, Issue 17, 9543-9548, August 15, 2000

 

 

 

 

 

 

 

return to top

C. Reverse Transcription-PCR.

Reverse transcription-PCR was performed and its products were quantitated as described (22). Total cytoplasmic RNA was isolated from cultured cells or BAT by using the RNazol method (TM Cinna Scientific, Friendswood, TX). A control experiment without reverse transcriptase was performed for each sample to verify that the amplification was not caused by any residual genomic DNA. The mRNA for -actin was examined as the reference cellular transcript in each PCR reaction. The nucleotide sequences of the amplified products were determined, and were found to be identical to the mRNA products of the rat and mouse TNF-, 3-adrenoreceptor, uncoupling protein 1 (UCP-1), and -actin genes.

Tumor necrosis factor mediates apoptosis of brown adipocytes and defective brown adipocyte function in obesity. Enzo Nisoli et al.
Proc. Natl. Acad. Sci. USA, Vol. 97, Issue 14, 8033-8038, July 5, 2000

 

 

return to top

 

D. RT-PCR

SVT35 parental and derivative cell lines were treated as indicated and harvested for total RNA isolation using TRI reagent (Molecular Research Center, Cincinnati, OH). For RT-PCR analysis, 2.5 µg of RNA was used for first strand RT reaction using the Superscript II Reverse Transcriptase (Life Technologies, Inc.). One-tenth of the resulting cDNAs were subjected to 23 PCR cycles in the presence of 0.1 µCi of [-32P]dCTP using the following primers: FasL, forward, ATGCAGCAGCCCTTCAATTACC, and reverse, CCAGTAGTGCAGTAGCTCATC; IL-2, forward, ATGTACAGGATGCAACTCCTG, and reverse, CAAGTTAGTGTTGAGATGATGC; and GAPDH, forward, CTCATGACCACAGTCCATGCCATC, and reverse, CTGCTTCACCACCTTCTTGATGTC. 5 µl of the amplified DNA samples were resolved in a 5% polyacrylamide/1? TBE gel, dried, and exposed to autoradiogram.

The NF-kappa B signaling pathway is not required for Fas ligand gene induction but mediates protection from activation-induced cell death, by Rivera-Walsh I, Cvijic ME, Xiao G, Sun SC
J Biol Chem 2000 Aug 18;275(33):25222-30

return to top

RT PCR in a scientific paper.

 

Explain how were obtained the data showed in the picture below. The try to tell as much as you can about their meaning. Why did they use beta actin?

 

(A) RT­PCR analysis of the expression of RU1 mRNA in various cell lines and organs. The renal carcinoma line was LB1047- RCC and the bladder carcinoma line was LB831-BLC. BB64-RCC cells were treated with IFNgamma for10 days where indicated. Dendritic cells were prepared as indicated in Figure 7. RT­PCR were performed on total RNA except for dendritic cells and thymus, for which poly(A)1 RNA was used.

 

from Sandra Morel et al Immunity, Vol. 12, 107­117, January, 2000, Copyright ã2000 by Cell Press

return to top

go back to Knowledge and to PCR